MISSION® esiRNA
SIGMA/EHU032871 - targeting human EMD
Product Type: Product-on-demand

Individual esiRNA in tubes. Photo is meant to be representative of packaging you will receive if ordered. Appropriate product information is printed on actual labels and package types are subject to change.
description | Powered by Eupheria Biotech |
Ensembl | human accession no. | ENSG00000102119 ![]() ![]() |
esiRNA cDNA target sequence | CTTTCGGATACCGAGCTGACCACCT |
form | lyophilized powder |
NCBI accession no. | NM_000117 ![]() ![]() |
product line | MISSION® |
Quality Level | 100 ![]() |
shipped in | ambient |
storage temp. | −20°C |
General description: | MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing. For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA ![]() |
Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
RIDADR | NONH for all modes of transport |
Flash Point(F) | Not applicable |
Flash Point(C) | Not applicable |
Storage Temp. | −20°C |
UNSPSC | 41105324 |