Advanced Search



MISSION® esiRNA

SIGMA/EHNC009791 - targeting human DLGAP4-AS1

Product Type: Chemical

Catalog Number PKG Qty. Price Quantity
45-EHNC009791-20UG 20 µg
$242.00
1/EA
Add To Favorites
45-EHNC009791-50UG 50 µg
$435.00
1/EA
Add To Favorites
Individual esiRNA in tubes. Photo is meant to be representative of packaging you will receive if ordered. Appropriate product information is printed on actual labels and package types are subject to change.

 

esiRNA cDNA target sequence ACGACCTCAATGGCCTGTAGAATCTGGGAGGCCGCCTCCGACCTAAGCCCAAAAAGCACATGATCGGGCTCACAGGGGGCGGCCAGAGGTGAAAACAGCCAACGCTTTACAACGACGCTGTGCGGGGCACTTCGTGTGTGTCATCCCGTCTCATCCTCGGGTGATAGGAACTGTTCATTCGGGAAAATTGCAAACAACTAAATACCCCTCACCAGGAGCTGGCCCATTATAGCAACTCTGAGACCTCTCTACCGCAGGCTCTTAAAATGGGTTTTCATCCCAACAGAATTTTTCTGAGGAACTTGATATACAAATTCTATAATTTATATTGGAAGAATGAAGATACAAGAATAGTTTTTCTTTCTGCACAAAAAGGATAAAGAAGGAGCACTCACCAGATACCAAGGCGTGCTACAAAGCCATGTGATTCTGTCCAAGCTTAACAGTGGATGTAACTGCTTCTTTGCTGTGGCAGATTGTATTTTCTGAAGGCCCCAACAGTCTCTCCTGTCCCTCCTCCTCTTCTGA
form lyophilized powder
GenBank accession no. BC039668 
product line MISSION®
shipped in ambient
storage temp. −20°C
General description: MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA .
Legal Information: GenBank is a registered trademark of United States Department of Health and Human Services
Legal Information: MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
RIDADR NONH for all modes of transport
Flash Point(F) Not applicable
Flash Point(C) Not applicable
Storage Temp. −20°C
UNSPSC 41105324

The following items have been added to your cart:

Choose a favorite list for this item:

Catalog Number Description Price
$

Returns/Order support

Please fill out the form below if you want to request order support from Krackeler Scientific.


Quick Order

* Required


New Year Price Updates

We are currently working diligently to update our website pricing information for the New Year. If you place an order, you will be acknowledged with any corrected pricing. If you'd like the most current information sooner, please don't hesitate to drop us an email or give us a call and we'd be happy to assist. Thank you for your patience while we are updating.

800-334-7725
office@krackeler.com


Play Video

To Request a Quote

  1. Search or Browse for items and add to them to your Shopping Cart.
  2. Click the "Request Quote" button at the bottom of the Shopping Cart page.
  3. Fill out required fields.
  4. Optionally you can convert to standard checkout mode by choosing a payment type.
  5. Click "Request Quote" at the bottom of the page.

You will be contacted with a quote.

To Order From a Quote

  1. Register and login to the website.
  2. Receive a quote from your sales representative or customer service.
  3. Have your copy of the quote in hand.
  4. Visit our quote module to search for your quote.
Back to Top