Advanced Search



MISSION® esiRNA

SIGMA/EHNC013651 - targeting human LINC00589

Product Type: Chemical

Catalog Number PKG Qty. Price Quantity
45-EHNC013651-20UG 20 µg
$220.00
1/EA
Add To Favorites
45-EHNC013651-50UG 50 µg
$391.00
1/EA
Add To Favorites
Individual esiRNA in tubes. Photo is meant to be representative of packaging you will receive if ordered. Appropriate product information is printed on actual labels and package types are subject to change.

 

esiRNA cDNA target sequence CATCCCCCACCACACAGTACCATGTACTGCTAAAGAACTCTAGAACATACAGGGTGTAGACGGCAGTCTTCTTGGGGAAAAAGAGGCTTCAGGATTGCAAGATTTCAGCTACTGTCTCTCCTCGGAGCAGGATTCCATCTTTTCCATGGCTGGGGCCCTTGACACATGTCACTGTGCACTGCTCTTCTCGCTGGGAAAAGGAAACTGAGGCCCAGAGAGGGCAAGTGAATTTCCCAAGAGTGTCCAGATGATACGGAGCTGAGCTGGAAAGTGAGCCTGGATCTCTCTGGTTCTGAAAGCTTTGCTCGAAAGCACAGGATGACACCTCCATTCAATCAATAAGCACTGAGACCCTTCCATGGACTCAGCAGGTCCTGCTGTCCCTGAAGGTTGACACTCTCATTTCAAACCACAGCGAGAACCCCAAAAGGAAACAGTGCAAGGAAAATAATGTGATATTTGAGAGGCAGCATGGATTATTGGGGACAGGGTTCATGTCCCTTCTCTCCCACACACGTGGCATGATGTTAAGCGGGTCACC
form lyophilized powder
GenBank accession no. BC003524 
NCBI accession no. NR_026765.1 
product line MISSION®
shipped in ambient
storage temp. −20°C
General description: MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA .
Legal Information: GenBank is a registered trademark of United States Department of Health and Human Services
Legal Information: MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
RIDADR NONH for all modes of transport
Flash Point(F) Not applicable
Flash Point(C) Not applicable
Storage Temp. −20°C
UNSPSC 41105324

The following items have been added to your cart:

Choose a favorite list for this item:

Catalog Number Description Price
$

Returns/Order support

Please fill out the form below if you want to request order support from Krackeler Scientific.


Quick Order

* Required


New Tariffs & Effects on Pricing

Tariff note: As we navigate the current environment of tariff surcharges and mid-year manufacturer price increases, we want to keep you informed. While we have avoided making specific decisions thus far, we anticipate that we will be forced to implement a cost adjustment policy to offset the fees we have already been absorbing. We are committed to transparency and moderation in this process.

800-334-7725
office@krackeler.com


Play Video

To Request a Quote

  1. Search or Browse for items and add to them to your Shopping Cart.
  2. Click the "Request Quote" button at the bottom of the Shopping Cart page.
  3. Fill out required fields.
  4. Optionally you can convert to standard checkout mode by choosing a payment type.
  5. Click "Request Quote" at the bottom of the page.

You will be contacted with a quote.

To Order From a Quote

  1. Register and login to the website.
  2. Receive a quote from your sales representative or customer service.
  3. Have your copy of the quote in hand.
  4. Visit our quote module to search for your quote.
Back to Top