MISSION® esiRNA
SIGMA/EHU018301 - targeting human PPARGC1A (2)
Product Type: Chemical
Individual esiRNA in tubes. Photo is meant to be representative of packaging you will receive if ordered. Appropriate product information is printed on actual labels and package types are subject to change.
| description | Powered by Eupheria Biotech |
| Ensembl | human accession no. | ENSG00000109819   |
| esiRNA cDNA target sequence | GTGACATCGAGTGTGCTGCTCTGGT |
| form | lyophilized powder |
| NCBI accession no. | NM_013261 |
| product line | MISSION® |
| Quality Level | 100 |
| shipped in | ambient |
| storage temp. | −20°C |
| Biochem/physiol Actions: | PPARGC1A (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional regulator which plays a key role in insulin signaling and mitochondrial regulation. It controls metabolism in many organs. For instance, it regulates gluconeogenesis in hepatocytes, thermogenesis in brown adipose tissue, and mitochondrial biogenesis and fatty acid oxidation in the heart. PPARGC1A also attenuates oxidative damage. Mutations in this gene are associated with type 2 diabetes mellitus. It is downregulated in prostate cancer. Presence of PPARGC1A inhibits prostate cancer progression and metastasis. However, presence of this protein gives selective advantages in breast cancer and melanoma cells. |
| General description: | MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing. For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA . |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| RIDADR | NONH for all modes of transport |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −20°C |
| UNSPSC | 41105324 |