MISSION® esiRNA
SIGMA/EHU084491 - targeting human CHAF1A
Product Type: Product-on-demand
Individual esiRNA in tubes. Photo is meant to be representative of packaging you will receive if ordered. Appropriate product information is printed on actual labels and package types are subject to change.
| description | Powered by Eupheria Biotech |
| Ensembl | human accession no. | ENSG00000167670   |
| esiRNA cDNA target sequence | GCCTGAATCTTGTCCCAAAGGGGAA |
| form | lyophilized powder |
| NCBI accession no. | NM_005483 |
| product line | MISSION® |
| Quality Level | 100 |
| shipped in | ambient |
| storage temp. | −20°C |
| Biochem/physiol Actions: | CHAF1A (chromatin assembly factor 1 subunit A) is one of the subunits of CAF1 complex, a histone chaperone responsible for the positioning of histone H3 and H4 dimers into nucleosomes. CAF1 is needed for S-phase progression, heterochromatin formation and chromatin restoration after DNA repair. CAF1A is required for promoting protein and chromosome associations with nucleoli. It is required for cell proliferation and is upregulated in colon cancer and aggressive neuroblastoma. |
| General description: | MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing. For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA . |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| RIDADR | NONH for all modes of transport |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −20°C |
| UNSPSC | 41105324 |