MISSION® esiRNA
SIGMA/EHU093271 - targeting human VAMP7 (2)
Product Type: Product-on-demand
Individual esiRNA in tubes. Photo is meant to be representative of packaging you will receive if ordered. Appropriate product information is printed on actual labels and package types are subject to change.
| description | Powered by Eupheria Biotech |
| Ensembl | human accession no. | ENSG00000124333   |
| esiRNA cDNA target sequence | GAGCACAGACAGCACTTCCATATGC |
| form | lyophilized powder |
| NCBI accession no. | NM_005638 |
| product line | MISSION® |
| Quality Level | 100 |
| shipped in | ambient |
| storage temp. | −20°C |
| Biochem/physiol Actions: | VAMP7 (vesicle-associated membrane protein 7) is mainly involved with granule trafficking and secretion. It is a platelet VAMP isoform, which is associated with fusion processes during membrane remodeling. It is responsible for neurite outgrowth, lysosome secretion during cell movement, vesicular transport to the apical membrane in epithelial cells, autophagosome biogenesis, release of autophagic vesicles, heterotypic fusion of late endosomes with lysosomes and homotypic lysosomal fusion. VAMP7 is also involved with the fusion of trans-Golgi network-derived lysosome-linked membrane protein carriers with late endosomes. Increase in the gene copy number of VAMP7 causes alteration in estrogen receptor action, thereby disrupting male urogenital development. |
| General description: | MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing. For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA . |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| RIDADR | NONH for all modes of transport |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −20°C |
| UNSPSC | 41105324 |