MISSION® esiRNA
SIGMA/EHU135311 - targeting human DLG1
Product Type: Product-on-demand
Individual esiRNA in tubes. Photo is meant to be representative of packaging you will receive if ordered. Appropriate product information is printed on actual labels and package types are subject to change.
| description | Powered by Eupheria Biotech |
| Ensembl | human accession no. | ENSG00000075711   |
| esiRNA cDNA target sequence | TGGGACCTATGAAAGACAGGATAAA |
| form | lyophilized powder |
| NCBI accession no. | NM_001098424 |
| product line | MISSION® |
| Quality Level | 100 |
| shipped in | ambient |
| storage temp. | −20°C |
| Biochem/physiol Actions: | DLG1 (disks large homolog 1) is a postsynaptic density protein. It is associated with the trafficking of GluA1 subunit of the glutamate receptor into synapses. It is also required for organizing brain circuitry. DLG1 is linked with neuropsychiatric disorders. It negatively controls the Wnt/β-catenin signaling pathway. It also participates in cell polarity and proliferation. |
| General description: | MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing. For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA . |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| RIDADR | NONH for all modes of transport |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −20°C |
| UNSPSC | 41105324 |