MISSION® esiRNA
SIGMA/EHUFLUC - targeting FLUC
Product Type: Chemical
| description | Powered by Eupheria Biotech |
| form | lyophilized powder |
| product line | MISSION® |
| Quality Level | 100 ![]() |
| shipped in | ambient |
| storage temp. | −20°C |
| General description: | EHUFLUC targets Firefly Luciferase. It can be used as a negative control in systems lacking Firefly Luciferase, or a positive knockdown control in systems expressing it. |
| General description: | MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing. For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA . |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| Other Notes: | esiRNA cDNA target sequence: GAGCAACTGCATAAGGCTATGAAGA |
| RIDADR | NONH for all modes of transport |
| WGK Germany | WGK 1 |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −20°C |
| UNSPSC | 41105324 |

