MISSION® esiRNA
SIGMA/EMU036241 - targeting mouse Ap1m2
Product Type: Product-on-demand
Individual esiRNA in tubes. Photo is meant to be representative of packaging you will receive if ordered. Appropriate product information is printed on actual labels and package types are subject to change.
| description | Powered by Eupheria Biotech |
| Ensembl | mouse accession no. | ENSMUSG00000003309   |
| esiRNA cDNA target sequence | ATCACACAACAGGGCAACAAGCTGG |
| form | lyophilized powder |
| NCBI accession no. | NM_009678 |
| product line | MISSION® |
| Quality Level | 100 |
| shipped in | ambient |
| storage temp. | −20°C |
| Biochem/physiol Actions: | Ap1m2 (AP-1 complex subunit μ-2) is a μ1B subunit of AP-1B (adaptor protein). In polarised epithelial cells, AP-1B is responsible for basolateral sorting of membrane proteins. Absence of the Ap1m2 gene in mice results in T-helper (Th)17-dominant colitis and intestinal epithelial cell hyperplasia. Ap1m2 is associated with expression of antimicrobial proteins and the luminal transport of secretory IgA (immunoglobulin A). |
| General description: | MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing. For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA . |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| RIDADR | NONH for all modes of transport |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −20°C |
| UNSPSC | 41105324 |