MISSION® Lenti microRNA, Human
SIGMA/HLMIR2167 - hsa-miR-6125
Product Type: Chemical
| concentration | ≥1x106 VP/ml (via p24 assay) |
| form | liquid |
| mature sequence | GCGGAAGGCGGAGCGGCGGA |
| product line | MISSION® |
| Sanger mature/minor accession no. | MIMAT0024598 ![]() |
| Sanger microRNA accession no. | MI0021259 ![]() |
| shipped in | dry ice |
| storage temp. | −70°C |
| General description: | Sigma’s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase. Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells. |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| Other Notes: | Based on miRBase V20 Mature ID |
| Other Notes: | Two negative controls are available: NCLMIR001 and NCLMIR002 |
| RIDADR | UN 3245 9 |
| WGK Germany | WGK 3 |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −70°C |
| UNSPSC | 41106609 |

