Advanced Search



MISSION® Lenti microRNA, Human

SIGMA/HLMIR2167 - hsa-miR-6125

Product Type: Chemical

Catalog Number PKG Qty. Price Quantity
45-HLMIR2167
$0.00
1/EA
CALL FOR PRICE
Add To Favorites
This image is provided for informative purposes only and does not represent an actual product label. It should not be used as a substitute for official product labeling.

 

concentration ≥1x106 VP/ml (via p24 assay)
form liquid
mature sequence GCGGAAGGCGGAGCGGCGGA
product line MISSION®
Sanger mature/minor accession no. MIMAT0024598 
Sanger microRNA accession no. MI0021259 
shipped in dry ice
storage temp. −70°C
General description: Sigma’s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Legal Information: MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Other Notes: Based on miRBase V20 Mature ID
Other Notes: Two negative controls are available: NCLMIR001 and NCLMIR002
RIDADR UN 3245 9
WGK Germany WGK 3
Flash Point(F) Not applicable
Flash Point(C) Not applicable
Storage Temp. −70°C
UNSPSC 41106609

The following items have been added to your cart:

Choose a favorite list for this item:

Catalog Number Description Price
$

Returns/Order support

Please fill out the form below if you want to request order support from Krackeler Scientific.


Quick Order

* Required


New Tariffs & Effects on Pricing

Tariff note: As we navigate the current environment of tariff surcharges and mid-year manufacturer price increases, we want to keep you informed. While we have avoided making specific decisions thus far, we anticipate that we will be forced to implement a cost adjustment policy to offset the fees we have already been absorbing. We are committed to transparency and moderation in this process.

800-334-7725
office@krackeler.com


Play Video

To Request a Quote

  1. Search or Browse for items and add to them to your Shopping Cart.
  2. Click the "Request Quote" button at the bottom of the Shopping Cart page.
  3. Fill out required fields.
  4. Optionally you can convert to standard checkout mode by choosing a payment type.
  5. Click "Request Quote" at the bottom of the page.

You will be contacted with a quote.

To Order From a Quote

  1. Register and login to the website.
  2. Receive a quote from your sales representative or customer service.
  3. Have your copy of the quote in hand.
  4. Visit our quote module to search for your quote.
Back to Top