MISSION® Synthetic microRNA Inhibitor, Mouse
SIGMA/MSTUD0046 - mmu-miR-134-5p
Product Type: Chemical
| form | solid |
| mature sequence | UGUGACUGGUUGACCAGAGGGG |
| microRNA accession no. | MI0000160 |
| product line | MISSION® |
| Quality Level | 100 ![]() |
| Sanger mature/minor accession no. | MIMAT0000146 ![]() |
| storage temp. | −20°C |
| General description: | Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2’-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor. • Long lasting inhibition at very low dosage • Excellent resistance to cellular nucleases • Custom synthesis available for a variety of species Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002) |
| Legal Information: | MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany |
| Other Notes: | Based on miRBase V19 |
| Symbol | GHS08 |
| Signal word | Warning |
| Hazard statements | H373 |
| Precautionary statements | P260 - P314 - P501 |
| RIDADR | NONH for all modes of transport |
| WGK Germany | WGK 3 |
| Flash Point(F) | Not applicable |
| Flash Point(C) | Not applicable |
| Storage Temp. | −20°C |
| UNSPSC | 41105324 |


