Advanced Search



MISSION® Synthetic microRNA Inhibitor, Mouse

SIGMA/MSTUD0195 - mmu-let-7a-5p

Product Type: Chemical

Catalog Number PKG Qty. Price Quantity
45-MSTUD0195 1 pkg
DISCONTINUED  
form solid
mature sequence UGAGGUAGUAGGUUGUAUAGUU
microRNA accession no. MI0000557
product line MISSION®
Quality Level 100 
Sanger mature/minor accession no. MIMAT0000521 
storage temp. −20°C
General description: Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2’-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

• Long lasting inhibition at very low dosage
• Excellent resistance to cellular nucleases
• Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Legal Information: MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Other Notes: Based on miRBase V19
Symbol GHS08  GHS08
Signal word Warning
Hazard statements H373
Precautionary statements P260 - P314 - P501
RIDADR NONH for all modes of transport
WGK Germany WGK 3
Flash Point(F) Not applicable
Flash Point(C) Not applicable
Storage Temp. −20°C
UNSPSC 41105324

The following items have been added to your cart:

Choose a favorite list for this item:

Catalog Number Description Price
$

Returns/Order support

Please fill out the form below if you want to request order support from Krackeler Scientific.


Quick Order

* Required


New Year Price Updates

We are currently working diligently to update our website pricing information for the New Year. If you place an order, you will be acknowledged with any corrected pricing. If you'd like the most current information sooner, please don't hesitate to drop us an email or give us a call and we'd be happy to assist. Thank you for your patience while we are updating.

800-334-7725
office@krackeler.com


Play Video

To Request a Quote

  1. Search or Browse for items and add to them to your Shopping Cart.
  2. Click the "Request Quote" button at the bottom of the Shopping Cart page.
  3. Fill out required fields.
  4. Optionally you can convert to standard checkout mode by choosing a payment type.
  5. Click "Request Quote" at the bottom of the page.

You will be contacted with a quote.

To Order From a Quote

  1. Register and login to the website.
  2. Receive a quote from your sales representative or customer service.
  3. Have your copy of the quote in hand.
  4. Visit our quote module to search for your quote.
Back to Top